24 November 2012

Review Jurnal : “Pola Distribusi Alotip Gen Polymeric Immunoglobulin Receptor (PIGR) pada Penderita Karsinoma Nasofaring (KNF) di Indonesia”


Karsinoma nasofaring (KNF) adalah tumor ganas yang tumbuh di daerah nasofaing dengan predileksi di fosa Rossenmuller dan atap nasofaring. KNF merupakan penyakit genetik multifaktor dengan karakteristik endemik. Tingginya insiden KNF di Negara-negara Asia  menimbulkan dugaan bahwa faktor genetik ikut berperan dalam patogenesis penyakit. Catatan dari berbagai rumah sakit di Indonesia menunjukkan bahwa KNF menduduki urutan keempat setelah kanker leher rahim, payudara, dan kulit. Selain faktor ras, makanan (makanan yang diawetkan, difermentasi, dan diasapi)  erat kaitannya dalam peningkatan insidensi KNF.
Makanan tersebut dapat meningkatkan kandungan nitrosamine yang dapat mengkativasi Epstein-Barr virus (EBV) dan menginduksi perkembangan KNF. Mekanisme EBV masuk ke dalam epitel nasofaring, masih belum jelas, namun diperkirakan sedikitnya terdapat 2 gen reseptor yang bertanggung jawab. Salah satunya adalah gen polymeric immunoglobulin receptor (PIGR). Mutasi gen PIGR diketahui berperan dalam patogenesis KNF di Thailand dan memiliki distribusi geografis yang berbeda secara signifikan. Oleh karena itu, diduga perbedaan distribusi genotip dan frekuensi alel gen PIGR juga terjadi pada populasi di Indonesia. Penelitian ini bertujuan untuk mengetahui adanya polimorfisme gen PIGR dan hubungannya dengan insidensi KNF pada populasi Indonesia.
            Beberata tahap yang dilakukan dalam penelitian ini yaitu :
1. Isolasi DNA genom : 1,5 mL sel darah tepi dicampur dengan 4,5 mL Red Blood Cells solution 1X (199 mM EDTA; 100 mM KHCO3; 1,45 NH4Cl), dibolak-balik 4-5 kali dan diinkubasi (suhu kamar; 10 menit). Campuran disentrifugasi  (1500 rpm; 10 menit;   27oC) sampai didapatkan endapan. Supernatan dibuang dan endapan dilisis dengan RBC 1X dan kembali disentrifugasi sampai endapan berwarna putih. Setelah supernatan dibuang, ditambahkan 1,3 mL Cell Lysis Solution (10 mM Tris HCl; 0,25 mM EDTA; 20% SDS). Suspensi dihomogenkan. Supensi diinkubasi (37oC; 30 menit). Kemudian ditambahkan 1,3 mL protein presipitasi (5M amonium asetat), divorteks 30 detik sampai terbentuk butiran-butiran halus. Suspensi disentrifugasi (3000 rpm; 4oC; 15 menit) sampai terbentuk endapan kecoklatan. Supernatan dipindahkan ke tabung baru berisi 2,3 mL isopropanol dingin, kemudian dibolak-balik beberapa kali sampai terlihat presipitat berupa benang-benang halus DNA yang melayang dalam isopropanol dan selanjutnya DNA diinkubasi semalaman pada -20oC. Kemudian tabung berisi DNA disentrifugasi ( 3000 rpm; 4oC;  5 menit). Supernatan dibuang dan endapan DNA dicuci dengan 1,5 ml alkohol 70% dingin, disentrifugasi (3000 rpm; 4oC; selama 5 menit). Endapan DNA dikeringkan dengan dianginkan (2 jam; suhu kamar). Selanjutnya ditambahkan 300 ml TE (10 mM Tris HCl; 0,25 mM EDTA) ke dalam tabung yang berisi DNA dan diinkubasi pada 37oC 2 jam. Kemudian DNA dipindahkan ke tabung 1,5 ml dan disimpan pada suhu -20oC.
2. Amplifikasi DNA gen PIGR : digunakan primer peneliti sebelumnya yaitu, forward 5’GGGTCCCGCGATGTCAGCCTAG3’ dan downward 5’TTCTCCGAGTGGGGAGCCTT3’. Amplifikasi DNA terdiri atas denaturasi, annealing, dan ekstensi DNA pada mesin PCR. Kondisi PCR yang digunakan adalah pre-PCR pada 95oC selama 4 menit, periode PCR selama 35 siklus meliputi denaturasi pada 95oC selama 60 detik, annealing pada 60oC selama 60 detik, dan ekstensi pada 72oC selama 60 detik. Setelah periode PCR, maka diakhiri dengan post-PCR pada 72oC selama 7 menit. Untuk kontrol negatif ditambahkan 10 mL ddH2O ke dalam larutan PCR.
3. Analisis Mutasi Gen PIGR dengan Teknik PCR-RFLP :Setelah diketahui hasil amplifikasi DNA PIGR positif dengan adanya pita DNA berukuran 220 bp dari elektroforesis,maka dilakukan analisis Restriction fragment length polymorphism (RFLP) menggunakan enzim restriksi Hga I. Deteksi mutasi gen PIGR mengacu pada penelitian sebelumnya. Hasil elektroforesis dinyatakan positif jika ditemukan 1, 2, atau 3 pita DNA PIGR yang berukuran 220 pb, 180 pb, dan 40 pb. Selanjutnya pita DNA tersebut dideteksi dengan iluminator UV dan direkam dengan film polaroid untuk analisis RFLP.
4. Analisis Statistik : digunakan metode analisis statistik nonparametrik,

Hasil dari penelitian ini yaitu :
·         KNF dan Faktor-faktor Pendukung Patologi KNF
Porsi penderita KNF (dari 102 pasien)
a. Berdasarkan stadium kanker :  76,47% pada stadium lanjut, 13,73% pada stadium awal, 6,86% belum diketahui stadium kankernya
b. Jenis kelamin dan etnis : rasio pria dan wanita (1,9 : 1) ; etnis jawa sebesar 34,31%, Sunda sebesar 29,41%, dan Batak sebesar 9,80%.
c. Faktor usia : 41-50 tahun dengan porsi 29,41%, diikuti usia 51- 60 tahun sebesar 24,51%, dan usia 31-40 tahun sebesar 23,53% dengan sebaran usia pada pasien KNF antara usia 15- 69 tahun.
·         Distribusi Genotip dan Frekuensi Alel PIGR pada KNFdan Kontrol
Dari hasil yang telah tertera pada tabel 1 di samping kemudian dilakukan uji chi-square. Dari uji chi-square didapatkan p>0,05. Hal tersebut menunjukkan frekuensi alel gen PIGR antara kelompok KNF dengan kontrol tidak berbeda nyata, ini berarti gen PIGR tidak berdisposisi dan berkontribusi pada patogenesis KNF.
·         Distribusi Genotip dan Frekuensi Alel Gen PIGR pada Kelompok Etnis di Indonesia
Dari hasil yang telah tertera pada tabel 2 di samping kemudian dilakukan uji chi-square. Dari uji chi-square didapatkan p>0,05. Hal tersebut mengindikasikan bahwa frekuensi alel gen PIGR antara kelompok pribumi tidak berbeda nyata dengan kelompok etnis Cina yang ada pada populasi Indonesia.
Berdasarkan hasil dan pembahasan penelitian tentang analisis polimorfisme gen PIGR pada penderita KNF dan individu normal dapat ditarik kesimpulan sebagai bahwa penderita KNF yang berobat ke RSCM kebanyakan berada pada stadium lanjut, didominasi oleh pria, mayoritas pada usia antara 41-50 tahun, distribusi alotip gen PIGR tidak berbeda antara individu kontrol dengan penderita KNF serta antara etnis pribumi dengan Cina pada populasi Indonesia sehingga mungkin tidak berhubungan dengan kerentanan individu terhadap timbulnya KNF. Dari hasil penelitian ini dapat disarankan perlunya dilakukan pemeriksaan alotip PIGR pada patogenesis KNF, terutama pada situs polimorfik Hga I sebagai pemeriksaan    pendahuluan bagi penderita KNF.

0 comments:

Post a Comment